EST 350169 is a singleton


Sequence

>350169 (1 EST) Length=236 CGAGGGAAAATACGAAAATTAGAACGCCGATTGAACTGGAAATGCAGGACGAATACATACTTGATTTAAAAAAGCATTAT TTACTAAAGAATGATGAAGAAAAATACGATGTTGTGCCCGAAATATGGGAAGGACATAATATCTCCGATTTTATTGCATC AGATGTTAGAGATATGTTAAAGTCAATCAGGAAAGAGGAAGAAGCAAAAATTCAAGCTGGGTACTATGATGATGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350169988800H48959SWMFCA006SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:16:58 on Fri 24 Nov 117.