EST 350170 is a singleton


Sequence

>350170 (1 EST) Length=232 ATCGGCACGAGAAGAGTTATCGGAGAATTGTTAAATCTATCTATATATGTGTTCGGTATCCTAATTACAATTACGGAATG GGACCGAGTCCAGTGGAGCAGAATCCGTGGGAACGCATGACAGTGACAGTGATGGTTGTCAGGATAATAATGATGGTTGG CATATTGGTTACGAAGTTGAAATGCATGGCATTGGTGTGGAAGAGTATTCAAGTAGCGGAGACGATATAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350170: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350170988801H48960SWMFCA007SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:18:17 on Sat 18 Nov 117.