EST 350176 is a singleton


Sequence

>350176 (1 EST) Length=239 ACAAATTCAAGCNCAATATTGCAATNAATGCCCAGAAGAAAAAAAACTGGAAACAAAGAGTACGAAACTATAAAGCATTA TGCTTTCTGATGCTAATGCAACATGCGGTGAACCTACAACCGCTCCTTCTCACGAAAAAAACTAAAAATGGCAACGTTGA ACCGTTTTTGCCTGTTCCATCAGTTGATTAAGTTGTTCAGTAGTCTACGTGACACCAGCGGTCTTGATGATTTAGACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350176988807H48966SWMFCA013SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 23:26:38 on Mon 20 Nov 117.