EST 350197 is a singleton


Sequence

>350197 (1 EST) Length=302 GNTGAATTATGCAATCATCACCGCATTACTTCTATTTGCAAGCATTCAGTTTGTNTCGATATTTGGAGAACTTTCATTGC TAGATCATGCGCTGTTTAACTTTACGGTGAGCTTAATGCAAAAAATAGCGAAGGACGATAAATCAGCCATTCTATCTCCT CTTTCTGTATCAACTTCACTGTTTATGGTTTACCTCGCAGCGGATGGCAAAACGAAGGAGCAATTGCAGAAAATTCTTGG TGGAACTGCAAGGACATCTGATCTTCGACAATACTTCGCCAATCAAATAGCTGATAGCGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 350197: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350197988828H48987SWMFCA034SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:43:55 on Sat 25 Nov 117.