EST 350212 is a singleton


Sequence

>350212 (1 EST) Length=363 GAATACTGTCTGCAATTTAGAAGAAAAGACTGGTGATCGTGGCCGTCTTGCACGTACCTCAGGTGAGTGAAATGCATCTT TTCTGAAAAGATGTGTATGATCTCAGGAAGACCGGGAAACAAAGACGATTAGATACAGATCCAGATGTGATCCAGAATTG TAGCACTTTGTTTTTAAACCATTTATACAGTTTTATTAGCCTATATACACTTTGGNNGGCAATTATGCCACTGTTGTTGC ACACAATCCAGAAACTAAGAAAACTCGTGTTCGNTTGCCTTCTGGCGCAAAGAAAGTCTTGGATTCTTCAAACAGAGCAA TGATCGGTATGTTTTAATTTTATGAAATTACTCGTGTATTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 350212: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350212988843H49002SWMFCA049SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 11:49:49 on Fri 24 Nov 117.