EST 350214 is a singleton


Sequence

>350214 (1 EST) Length=209 GAAAAAGTTCAAGAGAAGAAAAACGTAATCGTTCCCTTAAAGAATTAGAATTGAAATCTAAAGGATTTGAACTAGCCTCA GCTGATCATGCTCCAAATATTCTAAACGCAAGATGAAAATGAAGGACAAATTCTCTTTTAATTTATGTGAAATATTTTCG TTACATTATTGAAGCTGATGGGTTATATATATATATATCAATCTGTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350214: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350214988845H49004EST000094S. mansoni cDNA


Date: 6:53:1 on Sat 25 Nov 117.