EST 350218 is a singleton


Sequence

>350218 (1 EST) Length=141 ACTTTTCTCATTACAACTTCACCATTTAACTGTTTTTTGCTTGTATTATATTCTACTATTATAAAGCAATAATGATAAAA AGTTATGGAATAAGAGAAGACAGTTTTGTTTTCTTCGAATAGTGGAATGTTGTTGTGGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350218: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350218988849H49008EST000103S. mansoni cDNA


Date: 2:52:42 on Tue 21 Nov 117.