EST 350223 is a singleton


Sequence

>350223 (1 EST) Length=209 GTTCGAAAATACGTCTAAGAATAATATTTCTGACTTCCAACGATAATCATCAAAGGTAACAATAGTGGGTTACCGTCAAT CAAAAAATTATAAAGTAGATCCTTGATTATTGAAGAAATAAGTTATGGTTACTGATAATGACAGTGCTAACTTTGTCATT GAACCGAATAGATCCCTGGTCCCTTTTTTATGGTTGGGTAGTGACGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350223988854H49013EST000063S. mansoni cDNA


Date: 4:40:13 on Sat 25 Nov 117.