EST 350225 is a singleton


Sequence

>350225 (1 EST) Length=187 CAAAACTTCTCCCTAATTTTGTTGGATCAACAGATTCAGCAATGCCTTGTTCAATTATTTGAAAATGTGCGACATGCTTA ACTACGGCATTAAAGCACTGAAGAAATCTGATATTGGTTTGAAGCTGATATAAAAAGATGGAGAAGAAGCTTTCAACCAG TGGACAGATACTGATAGCTTATATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 350225: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350225988856H49015EST000065S. mansoni cDNA


Date: 15:33:13 on Fri 24 Nov 117.