EST 350226 is a singleton


Sequence

>350226 (1 EST) Length=154 CCGTTCATATTTTCATATACATATATCTGTTAGTGAGTCGGTAATTACAGTTACTTGTTTTTTCAGTTCATATGAATCAA ACGAAAATCTTAAATGAAAAAGTAGCTTTTGTGTTTCGGTGTTTACATTTGGGGACTCAACTGTTTATGTTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350226: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350226988857H49016EST000067S. mansoni cDNA


Date: 20:44:8 on Thu 23 Nov 117.