EST 350228 is a singleton


Sequence

>350228 (1 EST) Length=195 TAGTTAATCAATTACTTTCTTGTATACGATTACCTTCTAGTCGTAAGATACGAGTATAATGACCGAATAAAATATATTTT ATTAATTATGCAATAATAAGTTTTTCACAATTTGATTATATAATAATGTAGAATCAATTTATATACATAAAGTGAACAAT TTCTTATTATTCAGAAAGCTATTGTTCACAAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350228: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350228988859H49018EST000073S. mansoni cDNA


Date: 15:20:56 on Fri 24 Nov 117.