EST 350231 is a singleton


Sequence

>350231 (1 EST) Length=167 AATCATATACCATTATATTTATGGGGTGGAGATATTGGCTATTTCGAGAAGAATACAATTCATAAATTTATGTCATCTGT TGGTATAGAATTAATTTTTTGGATGGATAATAATGGAATAATGCGTATTGGATATGAGGTCTACCACGTGATCATGCTAA GTATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 350231: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350231988862H49021EST000076S. mansoni cDNA


Date: 17:45:16 on Tue 21 Nov 117.