EST 350232 is a singleton


Sequence

>350232 (1 EST) Length=116 GTTCTTCTCTATTAACCTTTTTTTGATTTTGTCAGTTTCTTCTCTTTGTTCCTCCCCCTTTATATACCTCCCACTTAATG TAGTTGAAAATATATACTCTTCCAAATAAATTGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350232988863H49022EST000089S. mansoni cDNA


Date: 16:18:6 on Sat 18 Nov 117.