EST 350234 is a singleton


Sequence

>350234 (1 EST) Length=182 TGCTGACGATAAGATAAACACTAATAATGATGATGAAAAATAGTATCAAAGAACAAATAATAGAGGATCCACGTATTGCA TTTTGGCGTGGAAGAATAGGTCATTTTCAATCAGGTGAAGTAAACTTAGGTAGAATAGTTACACCAAATCAATTAATTCG AGAATCAAACGAAACGTGCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350234: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350234988865H49024EST000115S. mansoni cDNA


Date: 19:22:50 on Fri 24 Nov 117.