EST 350237 is a singleton


Sequence

>350237 (1 EST) Length=114 TTATTATTACTGTTATTAGTCTCTTCTCTTCGTTTTTCCCTAATTATTGTATACATGCATTTCCATTGTGTTTTGTAATA AAGTTTGATCAGGAAAATAATCATTATAGATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350237988868H49027EST000127S. mansoni cDNA


Date: 16:59:47 on Wed 22 Nov 117.