EST 350238 is a singleton


Sequence

>350238 (1 EST) Length=209 CAATGTAAGTGAACTTGAACAAACATTGAATGCTTTGCAATCTAACTTAAATGAATTATTAATTGAAAATGACAAATTAG ATAAACAAATAATTCAAGATACAGTTGAAACTAGAAAAGCGTACAGAAAGAATTAGATCGAGCTACAACTCAAATATAAA CGATCAAAAACTGGCCTTAATGGAAGACGAAGAAGAAATGCAGTGCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350238: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350238988869H49028EST000133S. mansoni cDNA


Date: 11:1:6 on Tue 21 Nov 117.