EST 350239 is a singleton


Sequence

>350239 (1 EST) Length=154 GATGTTTCTTGATGTATAATCAAGACTTACTCACTTACTTACTTACTTACGCCTGCTACCCCTCGTGAAGGAGCATAGGC CGCCCACCAGTTCTGGTTACGCTTTCTCAGAGAGTTGGTTTTCTACAGGATGGACTGCCTAACCCCAGTCCCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350239: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350239988870H49029EST000141S. mansoni cDNA


Date: 15:0:43 on Thu 18 Jan 118.