EST 350240 is a singleton


Sequence

>350240 (1 EST) Length=193 CTGGCTTGAGTTGAGCTAGAATATATTTTTTTTAAATATTATCAGATACCTTTAAGTGGATCCTAGAAAAAAGACAAACA GTTTGAATATATGGCCATGAAACTAAACACAATGGATAGAAGAGGCTTAATCGAAAAATTCTATCGAAATGGATAAAAAT TGTGATGGCATTTAAACGCCTCTGAATTCGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350240: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350240988871H49030EST000147S. mansoni cDNA


Date: 23:10:25 on Mon 20 Nov 117.