EST 350241 is a singleton


Sequence

>350241 (1 EST) Length=142 CCAGTGCAATTTATAGAGTCTTTATGTACATTACAACAAGATNTCAAAGCTCACTGCACTGAAGGGTTGTTCCGTATAGA GCTATTTTTAATTACTGCCATGGTCAAACTTCAAGATATGAATGTTGGAAACCAGTTAACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350241: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350241988872H49031EST000149S. mansoni cDNA


Date: 12:20:20 on Fri 17 Nov 117.