EST 350243 is a singleton


Sequence

>350243 (1 EST) Length=134 GGGAAACCTATTTTAATTTAATAGTAATTACTGTTTTTCACTTTCTGTTTTGTTTTGTTTACAATTAGTCTTTATTATTT TTATTATTGAATAATAATGTGAAGAGCTCTGTAATCATATGTGTGTGTACATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 350243: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350243988874H49033EST000159S. mansoni cDNA


Date: 3:45:44 on Sat 18 Nov 117.