EST 350244 is a singleton


Sequence

>350244 (1 EST) Length=198 TTTGTAAATCAATTATCACGATCCATATCATATGAACATTCAGGGAATCGTATCCATATACAAACACGATGTCCAATTGT TTGTATCTACAGCAATGAATGGTTATTGTAAAATGTCATTATTTGTACCAAATGCTAAAGAATATGGTAAAAATGCATTA GAGATGTTAGGTGTTGAAGAAGAAACATTTGGTTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 350244: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350244988875H49034EST000160S. mansoni cDNA


Date: 9:15:49 on Sat 18 Nov 117.