EST 350246 is a singleton


Sequence

>350246 (1 EST) Length=166 TATTCTTAGTATTTCCTTAACTACCATTGTAATTTAGTCNTTTCCTCTAAAAAAGATTCATTTTCTTACTCATTAAATGA TAATTGATTACACTCACGCACAAGTGACAAAACTACTGTTTTTTGAGAAAAATTATCTACTCACAAGCTGTCAACTCCAT ACCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 350246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350246988877H49036EST000179S. mansoni cDNA


Date: 0:35:32 on Fri 24 Nov 117.