EST 354110 is a singleton


Sequence

>354110 (1 EST) Length=393 AAGTTGGAAGGACTTACTGTACNGGATGATGAAAAAATGTATCGAACCGACCCAAGCAGATGAAATGTTCTCTACGACCA AATATGAACTGTATGGATTAAAGGGTTGCGATGGGACNACTAATACNTCTGATTCTGAGGCAAAATTGATGCATGCCTCA GGAAGTACCTTGAGGAGTAAAACTTCATGTGCACGACTATTAAATGATTTAAACAGAATTGGCAGATTTCCGAGACATTT AAAAAAACTGTTCCGCATGCTTCTACTTCCGGTTATTATTTTTATTGCATTGTTCATCTTCATTACATATTCCTCGGAAA TCTTCAACAAGATACTGCGTACTGGATTGGANGAACCTGTTGCTCAACCCATCGGGNGGTTCTTTTATCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 354110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
354110992884H52888SW3ICA432SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:5:37 on Thu 23 Nov 117.