EST 354112 is a singleton


Sequence

>354112 (1 EST) Length=309 CATGATCACTACNTATCATCATCATCATCATTGTCATCAATGCCAAATTATCATTGTTGTGATTTTGGCTTTATGTTCAG AAATTGTGAAGTTACAGTCATCCATTGCTATCTGTTATCATTGCTATCTTCGTGACTGATATATTGTTCAACTGTTTGTG TATCATCGTCAGTTATCATTTCTAAATTGCTGCCAACTTCTTTCTGATTGCTATTAGCAATGAGAAATTAGTAGCTTGTG CTAATAATAAGAGAAAATAATGATGAAAATCATATCACAAATGATGATAACTTAACAAGACGAATAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 354112: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
354112992886H52890SW3ICA434SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 6:15:59 on Wed 22 Nov 117.