EST 364465 is a singleton


Sequence

>364465 (1 EST) Length=445 GGCCGTCTAGAGCGGTTTATNACCAAGTTTGAGGTAGATATTAGATGACTCTCAGGTAGATTGAGGTGCACATCGATATC CTTGATTGTCTTGTATATAATCGAGGATTCAGAGTCGGACAGGACAGGAGGATAGCTCACTGTGATGGAGGAGCAGACAC ATATGTTGTTGATGGATACGCGCTAGAGCGGTAGGCCAGTGGGCAGTATGCGTTTGGTGGCTGCCTCTGAGAAGAAGTAA GGAGATAGATTCGATATTTATTTACTAGTAAACCTATCGATATTCATCCATCGCCATATCATTACAATTCCAATTTCCGT TCTTGCAGATGGTGATTGGTCAGGGTCAGCAGTTTATCTAGGAATTTCACTGTAGTTCTGGCCAGATTGTAAATCATATT CATAATGCATATTATTGTCGGAGCAGCTGTACGTATGGATATCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 364465: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644651017392H63046AS3ISB082T3Brugia malayi infective L3 JHU93SL-BmL3


Date: 11:52:40 on Wed 22 Nov 117.