EST 364472 is a singleton


Sequence

>364472 (1 EST) Length=381 GCGGTTATTACCCAAGTTTGAGATGGATGATGTAGTCATGATGTTAGAAGTAGATCCGTAAACAATGCATCATAAAATAA TCTCAGAGCATCCATCACTCAATTTTATCACCAAAGGATGGTATCAAGGATACAGGGCAGATGTAGATATTAGTGGACAT ATAAGATCCACAATATGGCCGGTTAGGGATGCAGTGTTTTTGTTGGGTGAATATGACAAGTTTGTACAACTCATGCACAC CATTTCGTCCCATTAAAACCACGTTTATGCTTAGAGGGACGATGACATCATAAGACGTCGTCCAGATCAATTTTCTTAGT CCTGGAATGTCTTAGTTTTAGGAAATCAGGAAATTAATTCGATTTGGAATTATTCGAGCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 364472: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644721017399H63053AS3ISB094T3Brugia malayi infective L3 JHU93SL-BmL3


Date: 9:6:36 on Tue 21 Nov 117.