EST 364480 is a singleton


Sequence

>364480 (1 EST) Length=376 GNGGTTNACTTACCAAGTTTGAGGTAGTAAGATGGTTGATTCTGATGATCCGAAATAGTTTCTCATTGAGGTAGAAAGTA TGAAAAAGCTTGCCTTTTGTGGTGTTGTTGTTTCTACCGTAGCTACTCTGGTAGCAATTATTTGCGTACCAATGCTCTGA ACCTACATGCAAAATGTGCAGTCTAACTCGCAAGATGAGATTAGCTTCTGCAGGACACGCGCAATTGGCTTACGAGGAGA ATTCGATTTCATGCTTATCGATACCGCCGACCTCGAGGGGGGGCCCGGTACCCAATTCGACCTATAGTGAGTCGTTATTA CAATNCACTGGCCCCTCGTTTTTTACAACCGTTCGTTCACCTTGGGNTAAAACTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 364480: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644801017407H63061AS3ISB155T3Brugia malayi infective L3 JHU93SL-BmL3


Date: 12:19:22 on Fri 17 Nov 117.