EST 365799 is a singleton


Sequence

>365799 (1 EST) Length=159 GGTGATAGCAGCTAAAAGCTAGAATACTACTGGTGGCGGCAAAGAAATGTCTTNATTTNNAGAAGTTAGATGCAAAATGA TTTAGGAAAGGAAAGGTAGTTCTGAATTCTAAGTTCAACAGTTCTTTAATAAAATTTNAGCTGTTTTAACTGATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 365799: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3657991019972H64211RRAMCA004SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 11:51:24 on Fri 24 Nov 117.