EST 365801 is a singleton


Sequence

>365801 (1 EST) Length=172 TTGCACCAATGGCCCCAGTATACATGGGAACCAAGATTGTACAGGACAGCCAACAAACAGTTCCTTTTTAGAAGTGATCG CATCCGGTCTCCTGAAAAGACACAGTGTTGGCAGAAAGAAATGAGCACTACTCCCGAACCATAAGCAAGAACTAGATTAC TAGATCATAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 365801: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3658011019974H64213RRAMCA007SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:8:10 on Fri 17 Nov 117.