EST 370246 is a singleton


Sequence

>370246 (1 EST) Length=342 ATGCAAGCTGAAGTAGTGAAAATTTGTGCTGAAGCTTTGGAAACATATAACATTGAGAAGGATATTGCTGCTTTTATTAA AAAAGAATGCGACAAGAGATACANNCCANCCTGGCATTGTATAGTNGGCAGAAATNTTGGCAGCTACGTGACCCATGANA CCAAACATTTTATCTACTTGTACCTTGGACAGGTCGCANTTCTTGCTTTNTAAATCTGGATGATTGATTTGGTATAACCT ATACATAANNNCCCANACTTATCGTTTTTTTTACTGCCTTCGTTGTATCNACCAGTTGTCTTAACGTCTAAATANGCCAA CTAAAAATCAATTGGAAATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 370246: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3702461027398R95539SMNHADA001041SKSmAW


Date: 13:20:43 on Thu 23 Nov 117.