EST 370247 is a singleton


Sequence

>370247 (1 EST) Length=60 TTATATTACGGTTCGNTGTTGTTATCAATTATTCTGAATAAATTGTATGTTTTATCTCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 370247: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3702471027399R95416SMNHADA009054M13SmAW


Date: 23:46:51 on Sat 18 Nov 117.