EST 379553 is a singleton


Sequence

>379553 (1 EST) Length=236 ATTTCTCGTTACGGATGGAAGCGTATATTATGATATTGAAATTGATGATGATGATTGGATTCGTATAAATGTTGAACGAG GTGATCTTATCATTATACCGTCTGGTCGTAATTATCGCTTCACATTAACNACACAGAACNANGTTGTTATTCAACGTTTN NTCGGAACAAAACATCTGACTCAACAAGGATAANTATGACAGAAGTGATACATNTCAAGTAGTGNGGATTGATTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 379553: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3795531054519H77268SW3ICA483SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:27:1 on Sun 19 Nov 117.