EST 387963 is a singleton


Sequence

>387963 (1 EST) Length=131 TGTGTTCGAAGTAGGAGCACATTGTTATGCACTAGAAGTTGGTGATAATAATGTTTTTGAAGCAAAGTGTCATATTGGGA TCAAATGTTAAGATAACTCAGGTTGTGTAATTGGTGCAATGTGTTCAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 387963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879631065977H85663EST000345S. mansoni cDNA


Date: 14:40:13 on Fri 17 Nov 117.