EST 387964 is a singleton


Sequence

>387964 (1 EST) Length=60 GAGTTGCCTTCCCTTCTTTTACTTTGATTTTAATGAGCCTATACTCCTTTCTTCTTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 387964: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879641065978H85664EST000348S. mansoni cDNA


Date: 16:29:22 on Fri 17 Nov 117.