EST 387965 is a singleton


Sequence

>387965 (1 EST) Length=165 TCTGGACATATTATTATCAAAAGAACAAATGTAAAAAATAGTATCACTTTACAGCCCGCTTCAAAATATCCTAAATAATG ATACCACAATGAAACAATCGGAACGTAAAGAATAAAGATGAAATTGCAAGATAACCACTTACTAAACAAGTTAGCAGTAC GATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 387965: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879651065979H85665EST000406S. mansoni cDNA


Date: 1:3:33 on Tue 21 Nov 117.