EST 387967 is a singleton


Sequence

>387967 (1 EST) Length=134 CAACTACTATTACTACTTTTATGTTGTAATTATAAACGCTTTTTTAAAAAAAGAAGGGGCTAGGCTGAATATTTATTGCC CAGAGACAAAAGTAATCTAAACCGTACATAGTTTCATGCTTTTGGTTTTATACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 387967: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879671065981H85667EST000409S. mansoni cDNA


Date: 16:30:44 on Fri 17 Nov 117.