EST 387970 is a singleton


Sequence

>387970 (1 EST) Length=120 CATTTTGTACACAAATTCAACTAGTTCTTAATCACTGACATTTCTGTTTATTGTTCCATTCGATCGAACTCTTAAGATAA ATAAAAAGCGTCTATTCAGGAATTCGATCTAGTGGACATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 387970: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3879701065984H85670EST000417S. mansoni cDNA


Date: 16:56:15 on Wed 22 Nov 117.