EST 39124 is a singleton


Sequence

>39124 (1 EST) Length=411 TCTAGATAAATATCGAAAATCGGACTTTGTTGCGTATCCTGCCCTAAAAACACAAAGGTTATGGGAAGTCCAACCACAAG AACCAAAAAAGGAGACGAAACGTCTGTATCAAGAACTCGTACCACATTTTATTGACCCAAGATACCGCGATCGTCTACGT GAACGTCTTGAGCGTTGTGAAATGATGCTACGTCGTCGAAATTTAGATATACCAGAGTTTTATGTAGGGTCAGTTGTTGC CGTAAGGACTGCTGATAAATTTGCGCCAGACCAATCACATCGATTCATGGGTATTTGTATAGAACGCTTTAATGAAGGTT TGTGGACAAAATTTACTCTTCGTAACGTGATTGAGAAAACAGCTGTTGAAATTCAGTATGAATTATATAATCCAACCATT CAGTCAATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39124: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39124514518T14351SMEST0012Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:42:41 on Thu 23 Nov 117.