EST 39129 is a singleton


Sequence

>39129 (1 EST) Length=275 GGAACGAGGGTGAAAGTTCCTTAAAAGATATAGAAAACTTCAACCAATCAACCGCAAATCCTAAATTAGTGATTGCNCTT CATTTACGTCAGTNCTCGCGTCTTGTCAGTCTGCTAGACAAAAGTATACCTGTCCTTTCAATTTGCACCGGGACTGATGT ATATATGGATAGAACTCATGAGGTATATCTGAAGCTGATGACATATTTAGTTGACCGAAGTTTTGCAGTTGTTTTGCTTA ACCAGCCAATGTTGAAGCAGTTTAAAGAAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 39129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39129514523T14356SMEST0017Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:11:7 on Sat 18 Nov 117.