EST 39130 is a singleton


Sequence

>39130 (1 EST) Length=337 CGACATTCAAATGCAGTATTAAAAAATGTATAGGATAATATATATGANCATGTTAAGCACATCAATATTTGGCCTTTCAA CCACTTTGATCACCTGTGTGACTGCCAGATGAATGTNCTCTTTGGGCACCCTCATCATGGTAGTCAGATGGCGACCGAGA TCTGAAACGGTGGTTGCTTTGTCGTGACCGGGAGCGTGAACGTGACACAGAACGGGAATTATGATTACGTGCACCAAGAT CACCAGGACTTGCATTGCGACCGTCGTCAACTGGACTACCTGAATCTTCGTAGCTATGTCTTCTTTCAACATCTGGTGTG TGAGAATGAGAGCGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 39130: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39130514524T14357SMEST0018Schistosoma mansoni, adult worm, Gloria Franco


Date: 20:52:19 on Thu 23 Nov 117.