EST 39131 is a singleton


Sequence

>39131 (1 EST) Length=271 ACGAGGTTTTCTGTTGGCTAGCATGCCGAAATACGATCGTCAAGCCAATGGGTACAGAGTATTCGTTGGAGGTGTGGACC CTCGTGTTGGAAAAGTTGATATAGAACAAGAGTTTGAGCGTTTTGGCCCAATAGCAGATGTATGGGTTGCTCGGAATCCA CCAGGGTTCGCATTCATAGTATTCAAGTATGCAGAAGACGCAGATCGAGCAGTTAGGCGAATGGATGGAAGTCGCCCTTT TGGGTCTCGTCTAAGGGTGGAACATGCGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39131: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39131514525T14358SMEST0019Schistosoma mansoni, adult worm, Gloria Franco


Date: 18:52:33 on Sun 19 Nov 117.