EST 39133 is a singleton


Sequence

>39133 (1 EST) Length=250 GGAACGAGGNATTGTCTTAGATATGCTGAACAGTGCTCGAAACGAACTCAACCACTTGCTTATCTTCCCAACGGCATAAA TNACAAAATATCACATAATGATTACTTTGCTCGAGATGGGCGACGCGAAGTTAGGAAATCTGTTGATATTTATGTTTCTG GCTTAAAAAGGCTTGAAGCTAGGTCAGAGTCTAAACGTCCAAATGTTCTATCAAAGTCGATTGATGTTGTCCCGGGACAA AAGTTTGACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 39133: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39133514527T14360SMEST0021Schistosoma mansoni, adult worm, Gloria Franco


Date: 22:33:43 on Thu 18 Jan 118.