EST 39146 is a singleton


Sequence

>39146 (1 EST) Length=230 TTGTGTTCAATATGTCTGGTGGGAAACAACATAACGCAGTAGTNATTCCTGTGAATCGTGAGCAACGGTCATTTGAGAAA CAAAGACGTGACTTATTGACTGGCCTGGAACATGGGGGTGGTGCTCATCGTGGCAACTCAATCGCACCATACACGGAAGA CTGGCCGAGTACAGTGGACAACTGGNTCGACTCCTCGTGGAAGAGATGGGATGACGACATGCGACGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39146514540T14373SMEST0034Schistosoma mansoni, adult worm, Gloria Franco


Date: 1:34:17 on Sun 19 Nov 117.