EST 39166 is a singleton


Sequence

>39166 (1 EST) Length=408 CTTTTATATAATGTATTCTACAATGTTACAATAGTAGAATGAAAGTACACTTGTNCTTAAAGATTAAAACAATTTAAAAA GAAGAGTAACAGAGGTAATTTATTTTNTTTGTTTTCCTGTAAAGCTATTAGTTAAATATGCATTAGCACTGGATGATAAT CTGGTGCATCTGTAAATATCAATCCAACAAATATATGATTCTCCCATTTTGGNTAACGTAATACTTGGCAACAAATAGAN TTATCTAATTCAAATCCAAAATGTTTCATTGTTTCANCGGTTTCTTTGAGTATAGCTTCGCCATGGGCTCCAATATACGG NNTCCCAGTGAACGGTTCANTAAAATCNGCCCAATAGCCTAATTCTTTTAATGATGAGCATATTTCTATTTGCTGAAGTA ATAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39166514560T14393SMEST0054Schistosoma mansoni, adult worm, Gloria Franco


Date: 6:18:48 on Fri 24 Nov 117.