EST 39169 is a singleton


Sequence

>39169 (1 EST) Length=330 CTTGGNGCCAATGCNATATTGGNAGTCTCTTTGGCTGTGTGCAAAGCTGGTGCAGCTGAAGCCGGTTTACCTCTCTATAG GTATATTGCNAGGTTAGCTGGGCATGAAGATGTTATAATGCCTGTCCCAGCATTCAATGTCATTAATGGTGGCAGTCATG CCGGCAACAAGCTAGCCATGCAAGANTTTATNATTCTCCCTACTGGGGCCAGCTCTTTCACTGAAGCAATGCAAATCGGT ACTGAGGTGTACCACAATTTAAAAGCTGTTATCAAACGTGAATATGGGCTGGNTGCATGCAACGTTNGTGACGAAGGTGG TTTTGCACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 39169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39169514563T14396SMEST0057Schistosoma mansoni, adult worm, Gloria Franco


Date: 2:46:47 on Mon 20 Nov 117.