EST 39171 is a singleton


Sequence

>39171 (1 EST) Length=251 ACAACAACAAACTAAATAATTTATTATTTATCAAGTATCTTATCAGGTTCACTTAACAAAAGGGAGAAACTTATGTAATA ATAATANCANTAATAATAAANCATTTCCATAATTNCTATATCGGTTCTTTATTTATTAGCATCAATAAATCTCCTGTTAA AGTCTCCCTTTTCTNGTCATTAGCATAACCTAAATCCTGTAGATTTTTTNCAGCGNTATTGAATATGATATCTACGAGGC CTTGGGTTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 39171: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39171514565T14398SMEST0059Schistosoma mansoni, adult worm, Gloria Franco


Date: 16:29:33 on Fri 17 Nov 117.