EST 391804 is a singleton


Sequence

>391804 (1 EST) Length=213 AAGATGAGGAAGATGGATGGAGTGGATGTAAAAGAGAATTTGCCAATTGGTNCTTTNGAAACTGTTCGATNAACCAACTG GATCGAAAGACGAGATGTGCNCTCAGCACATCATTGATAACTTATCGCATTACCCACACATTGATCCCAAAATAAAGTAC AGTAAATCCTTGCCNGAGTTAAAAATGATCATATCCAAAGATCCAAATATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 391804: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918041079823H89393RRAMCA052SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 15:19:53 on Wed 17 Jan 118.