EST 391808 is a singleton


Sequence

>391808 (1 EST) Length=283 ACGAGACTTAAAAGGGTTTAATNANAAATAAGGGTGAACGCTNAGATTTAGTTCCGAATATTCCGGAAAAGGNACTTCGG TTTAAGATTGTGCATTATCGTTGATAGTGTNACTTCACCGTCCACGTTGCCCACTCAACAGTTACCGTGACTCGNAAATA GATTTCGTGCTGCTCTTTATTTTTCAGTGGTTTTTTTCGGTTCGCAATTGAACGCATACTATAATGGTATAATCTCCGAA TATACCAATCAGCGAACAATAATCATCTTTCTGATTGTTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 391808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918081079827H89397RRAMCA056SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:28:52 on Wed 22 Nov 117.