EST 391809 is a singleton


Sequence

>391809 (1 EST) Length=248 ACGAGAGAAGGGNAACNAANAATGGAAACTATGAGAATTNTTATACTCATTTNATTAGCTGCTNCCATTGTTNAATCAGA ATATNATGCCNATTACNACGATCNATTGACAAGAGATTCGATGAATTTCGAAAAACGAGCGGTGCCATCTATGCGCAATA TGATCAATTTAAACAAAAGAAGTGACAGTGACAACGCCGGATTTGACCGCGAGTTTCTCCATTTCGGCCAAACGAGAAGG TGCCATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 391809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918091079828H89398RRAMCA057SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 12:7:41 on Fri 24 Nov 117.