EST 391817 is a singleton


Sequence

>391817 (1 EST) Length=222 GGATTTTTTGATTGAATAAGTACGCAATGAAATTAAATATTTCGTGTGCAACTAAAGTTTATCCTATAGAGGTTGACGTT GAAGAACTTTCAAATAACGTGGNTGTTTGTGAAGCTACTTCAGCTCAAGAGGATAGCAGTATTAGCACGAGTACAGTCGA TGCAGGAAGATCTCACGTTTGGGATCACTCAAACAGCACTTTGTTCATTGTCGAATTATTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 391817: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3918171079836H89406RRAMCA068SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:19:52 on Wed 22 Nov 117.